File sequence - PDFSEARCH.IO - Document Search Engine

File sequence
Results: 120

#	Item
51	Additional File 4 – The Converge Algorithm Converge attempts to learn DNA sequence motifs present in the upstream regions of co-regulated or co-bound genes in the genome of a species of interest (i.e. a primary genome Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Position-specific scoring matrix Sequence motif Nucleic acid sequence Phylo BLAST Bioinformatics Science Sequence alignment
52	Additional file 1 Table S1. The three pairs of primers used to amplify and sequence the entire DENV-4 envelope gene Primer Nucleotide sequence（5’～3’） Genome position Amplification size（bp） E1F GACAACAGAAGG Add to Reading List Source URL: www.biomedcentral.com
53	Additional file 1 – Saccharomyces cerevisiae transcription factors with known DNA-binding specificities REGULATOR KNOWN SPECIFICITY SOURCE1 REFERENCE ABF1 RTCAYTNNNNACGW Tfac ACE2 GCTGGT SCPD Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Genetics Gene expression DNA Upstream Activating Sequence Saccharomyces cerevisiae Pho4 Cell cycle TRANSFAC Cln3 Biology Transcription factors Proteins
54	Additional file 1: Supplementary Figures in this study. Figure S1 Overview of assembly by SOAPdenovo. (a) Length frequency distribution of contigs obtained from de novo assembly of high-quality clean “reads”. (b) Len Add to Reading List Source URL: www.biomedcentral.com Language: English Science Molecular biology BLAST Public domain software Contig Expressed sequence tag Venn Bioinformatics Biology Genomics
55	Additional file 1 – Primers and PCR condition for bisulfite genomic sequencing Gene PCR product Primer name Primer sequence PCR condition Product size Aicda 　 meAicda-F1-S GTGGTATTTGGGTTGGTTTTTTAGAGGAAT 94℃,1 min. Add to Reading List Source URL: www.biomedcentral.com Language: English Molecular biology Science Laboratory techniques Amplifiers Hoffmann-La Roche Biology Chemistry Polymerase chain reaction
56	Additional File 1 Identification of conformational B-cell Epitopes in an antigen from its primary sequence Hifzur Rahman Ansari and Gajendra P. S. Raghava§ Bioinformatics Center, Institute of Microbial Technology, Sect Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Lists by country Hindu population in England & Wales Hinduism in the United Kingdom
57	21_0672328623_ch18.qxd[removed]:04 PM Add to Reading List Source URL: assets.devx.com Language: English - Date: 2006-03-13 11:56:39 Archive formats Computer file formats Cross-platform software Pattern matching Files Comma-separated values Tar File sequence File format Computing Software System software
58	CI S 22A Beginning Programming M ethodologies in C++ - Summer 2014 I nstructor: Tony Nguyen Phone[removed]Email: [removed] Add to Reading List Source URL: deanza.fhda.edu Language: English - Date: 2014-07-08 11:38:57 Cross-platform software C++ C Sequence container Gmail Email Header file .cpp Computing Computer programming Software engineering
59	49th ANNUAL PSA STEREO SEQUENCE (ALL-DIGITAL) COMPETITION[removed]PSA Honors: PSA Member’s Name: Add to Reading List Source URL: www.psa-photo.org Language: English - Date: 2013-05-21 20:29:48 Email Binary file JPEG Stereophonic sound Computer file formats Computing Photographic Society of America
60	49th ANNUAL PSA STEREO SEQUENCE (ALL-DIGITAL) COMPETITION[removed]PSA Honors: PSA Member’s Name: Add to Reading List Source URL: psa-photo.org Language: English - Date: 2013-05-21 20:29:48 Email Binary file JPEG Stereophonic sound Computer file formats Computing Photographic Society of America

UPDATE